immR [2019-08-15 14:15:33]

transcriptional repressor ([SW|Xre family]), controls expression of genes of the mobile genetic element ICEBs1, induction by the SOS response or the [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI]-[protein|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|PhrI] sensory system

locus: BSU_04820

pI: 4.99

mw: 14.51 kDa

protein length: 127 aa

gene length: 384 bp

function: control of transfer of the mobile genetic element ICEBs1

product: transcriptional repressor ([SW|Xre family])

essential: no

synonyms: ydcN

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]

Gene

Coordinates: 531,130 → 531,513

The protein

Protein family

• [SW|Xre family]

Effectors of protein activity

• binding of [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI] to ImmR results in loss of DNA-binding activity of ImmR and subsequently in induction of ImmR-repressed genes [Pubmed|17511812]

Expression and Regulation

Operons

• genes: [gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]-[gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]-[gene|47AE982C5E71F31B5AF04C4F50593C2629F8EDAF|int]
  description: [pubmed|22383849]

• genes: [gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]
  description: [pubmed|22383849]

Biological materials

Mutant

• BKE04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA
• BKK04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA

References

Reviews

• 24995588

Original publications

• 17511812,18761623,21036995